Transcript: Mouse NM_001114665.2

Mus musculus formin binding protein 1-like (Fnbp1l), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Fnbp1l (214459)
Length:
5377
CDS:
162..1991

Additional Resources:

NCBI RefSeq record:
NM_001114665.2
NBCI Gene record:
Fnbp1l (214459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001114665.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201845 GCAGTAAAGGTGCAGTAACTT pLKO.1 1963 CDS 100% 5.625 4.500 N Fnbp1l n/a
2 TRCN0000201739 GCCTAAATTAGCAGAGACCAT pLKO.1 1505 CDS 100% 2.640 2.112 N Fnbp1l n/a
3 TRCN0000130069 GAACAGAACTATGCGAAACAA pLKO.1 276 CDS 100% 5.625 3.938 N FNBP1L n/a
4 TRCN0000202309 GCAGACTCAGAACGCAAAGTT pLKO.1 861 CDS 100% 5.625 3.938 N Fnbp1l n/a
5 TRCN0000149452 GAGGGAAGTTACACTGATGAT pLKO.1 1668 CDS 100% 4.950 3.465 N FNBP1L n/a
6 TRCN0000201274 GCGAGAAGTAATAGTTGGATA pLKO.1 2406 3UTR 100% 4.950 3.465 N Fnbp1l n/a
7 TRCN0000432170 TACTAACTTCATTAGCATTTC pLKO_005 3314 3UTR 100% 10.800 6.480 N FNBP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114665.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.