Transcript: Mouse NM_001115010.1

Mus musculus lin-54 homolog (C. elegans) (Lin54), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Lin54 (231506)
Length:
4596
CDS:
304..2553

Additional Resources:

NCBI RefSeq record:
NM_001115010.1
NBCI Gene record:
Lin54 (231506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001115010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095105 GCCGTTTACATTTGTAACTAA pLKO.1 2355 CDS 100% 5.625 7.875 N Lin54 n/a
2 TRCN0000095107 CCGTTAAGCAAGTTGTTCCAA pLKO.1 1535 CDS 100% 3.000 4.200 N Lin54 n/a
3 TRCN0000095106 GCTTCCATTCAATGGCATAAT pLKO.1 1821 CDS 100% 13.200 9.240 N Lin54 n/a
4 TRCN0000422114 ACTCTACAGCCACGCCCATTT pLKO_005 467 CDS 100% 10.800 7.560 N LIN54 n/a
5 TRCN0000107669 CCCAATGTCCAGCAGATTCAA pLKO.1 1339 CDS 100% 5.625 3.938 N LIN54 n/a
6 TRCN0000095108 GAAGCCTTCAAGCCAAAGATA pLKO.1 2032 CDS 100% 5.625 3.938 N Lin54 n/a
7 TRCN0000107666 CCTGTGACTATATCAGCCAAT pLKO.1 622 CDS 100% 4.050 2.835 N LIN54 n/a
8 TRCN0000095104 CCTGATTCTATTGACAAAGAA pLKO.1 2829 3UTR 100% 5.625 3.375 N Lin54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001115010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.