Transcript: Human NM_001121.4

Homo sapiens adducin 3 (ADD3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ADD3 (120)
Length:
4317
CDS:
346..2370

Additional Resources:

NCBI RefSeq record:
NM_001121.4
NBCI Gene record:
ADD3 (120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001121.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296142 TAAGCGAGTGAGTAGGTTAAG pLKO_005 2178 CDS 100% 10.800 15.120 N ADD3 n/a
2 TRCN0000123028 CCCAACTGGATTACTAGCATT pLKO.1 597 CDS 100% 4.950 6.930 N ADD3 n/a
3 TRCN0000288998 CCCAACTGGATTACTAGCATT pLKO_005 597 CDS 100% 4.950 6.930 N ADD3 n/a
4 TRCN0000123027 GCCTCACAAAGAGAGATATTT pLKO.1 399 CDS 100% 15.000 10.500 N ADD3 n/a
5 TRCN0000296143 AGTGCCTGTCATGGTAGTAAA pLKO_005 2118 CDS 100% 13.200 9.240 N ADD3 n/a
6 TRCN0000296089 TAGTATACACTGGCACATAAT pLKO_005 2854 3UTR 100% 13.200 9.240 N ADD3 n/a
7 TRCN0000123025 GCCACCTTCTACTATGCAATT pLKO.1 1944 CDS 100% 10.800 7.560 N ADD3 n/a
8 TRCN0000123026 CCAGGGAAGTACCAATTTGAA pLKO.1 945 CDS 100% 5.625 3.938 N ADD3 n/a
9 TRCN0000288997 CCAGGGAAGTACCAATTTGAA pLKO_005 945 CDS 100% 5.625 3.938 N ADD3 n/a
10 TRCN0000123024 GCACATCTAAATACCACATTT pLKO.1 2412 3UTR 100% 13.200 7.920 N ADD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001121.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00026 pDONR223 100% 95.4% 95.4% None 1726_1727ins96 n/a
Download CSV