Transcript: Mouse NM_001122676.1

Mus musculus zinc finger, CCHC domain containing 2 (Zcchc2), transcript variant A, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Zcchc2 (227449)
Length:
5819
CDS:
385..3885

Additional Resources:

NCBI RefSeq record:
NM_001122676.1
NBCI Gene record:
Zcchc2 (227449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265344 CCCTAATGCGGTGGCTATTTC pLKO_005 2616 CDS 100% 13.200 18.480 N Zcchc2 n/a
2 TRCN0000251523 TAAATCGCTTCCAGGTAATTT pLKO_005 5020 3UTR 100% 15.000 10.500 N Zcchc2 n/a
3 TRCN0000240883 TGTACTTTATGGAGCTTATTT pLKO_005 5589 3UTR 100% 15.000 10.500 N ZCCHC2 n/a
4 TRCN0000251522 CTCTGCCTGTGGTGACTATAT pLKO_005 1308 CDS 100% 13.200 9.240 N Zcchc2 n/a
5 TRCN0000251520 TCCAGCTAAATAGTTACTATT pLKO_005 3428 CDS 100% 13.200 9.240 N Zcchc2 n/a
6 TRCN0000073041 CCTTCTAATGATACGTTGGAT pLKO.1 3853 CDS 100% 3.000 2.100 N ZCCHC2 n/a
7 TRCN0000251521 CCCAAGTGGTAGGACTAAATC pLKO_005 2975 CDS 100% 13.200 7.920 N Zcchc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.