Transcript: Mouse NM_001122730.2

Mus musculus trinucleotide repeat containing 18 (Tnrc18), transcript variant A, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tnrc18 (231861)
Length:
10308
CDS:
361..8928

Additional Resources:

NCBI RefSeq record:
NM_001122730.2
NBCI Gene record:
Tnrc18 (231861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256219 AGCGGATGTTTGCTATGAAAT pLKO_005 4538 CDS 100% 13.200 18.480 N Tnrc18 n/a
2 TRCN0000256218 TCACGACTCCTCATCTGATTT pLKO_005 4821 CDS 100% 13.200 18.480 N Tnrc18 n/a
3 TRCN0000217930 GCGGATGTTTGCTATGAAATC pLKO.1 4539 CDS 100% 10.800 15.120 N Tnrc18 n/a
4 TRCN0000198608 CGCGTGAACTGAACTCCAATA pLKO.1 4487 CDS 100% 10.800 8.640 N Tnrc18 n/a
5 TRCN0000247591 CTGACGTGCAGAATATTATTT pLKO_005 9860 3UTR 100% 15.000 10.500 N TNRC18 n/a
6 TRCN0000181383 CAGGCCCTGTTCACAGATATT pLKO.1 3352 CDS 100% 13.200 9.240 N Tnrc18 n/a
7 TRCN0000177960 GCGTGAACTGAACTCCAATAA pLKO.1 4488 CDS 100% 13.200 9.240 N Tnrc18 n/a
8 TRCN0000256222 CAGATAGAACTACCGAGTAAG pLKO_005 3823 CDS 100% 10.800 7.560 N Tnrc18 n/a
9 TRCN0000256221 TGCTGACATCAGACGACTATG pLKO_005 4697 CDS 100% 10.800 7.560 N Tnrc18 n/a
10 TRCN0000178435 GACGAAGACTTCCTGAAGAAT pLKO.1 5230 CDS 100% 5.625 3.938 N Tnrc18 n/a
11 TRCN0000181872 GAAATACATGGCCGGTCTCAA pLKO.1 510 CDS 100% 4.950 3.465 N Tnrc18 n/a
12 TRCN0000181586 GCACCATGAAACCTGAACCTA pLKO.1 1997 CDS 100% 3.000 2.100 N Tnrc18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.