Transcript: Human NM_001122752.1

Homo sapiens serpin family I member 1 (SERPINI1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SERPINI1 (5274)
Length:
1696
CDS:
199..1431

Additional Resources:

NCBI RefSeq record:
NM_001122752.1
NBCI Gene record:
SERPINI1 (5274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001122752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430898 ACTGCTAAAGAGAGCCAATAT pLKO_005 490 CDS 100% 13.200 10.560 N SERPINI1 n/a
2 TRCN0000052356 CGTGGCCAACTACATCAATAA pLKO.1 636 CDS 100% 13.200 10.560 N SERPINI1 n/a
3 TRCN0000425072 AGTCCTTCCTAGAGGTTAATG pLKO_005 1214 CDS 100% 13.200 9.240 N SERPINI1 n/a
4 TRCN0000052353 CCCTCATTAATGCTGTCTATT pLKO.1 734 CDS 100% 13.200 9.240 N SERPINI1 n/a
5 TRCN0000420225 GAATATGTATAATCGTCTTAG pLKO_005 291 CDS 100% 10.800 7.560 N SERPINI1 n/a
6 TRCN0000052354 GCTGTGCTGTATCCTCAAGTT pLKO.1 1288 CDS 100% 4.950 3.465 N SERPINI1 n/a
7 TRCN0000052355 GCCAATTCCTTGTTTGTGCAA pLKO.1 523 CDS 100% 2.640 1.848 N SERPINI1 n/a
8 TRCN0000052357 GCCTCTCTGATAATAAGGAGA pLKO.1 1169 CDS 100% 2.640 1.848 N SERPINI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.