Transcript: Mouse NM_001122978.2

Mus musculus caspase 8 associated protein 2 (Casp8ap2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Casp8ap2 (26885)
Length:
6566
CDS:
52..5940

Additional Resources:

NCBI RefSeq record:
NM_001122978.2
NBCI Gene record:
Casp8ap2 (26885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001122978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350090 GTATGGGATGCCAGGTAATAT pLKO_005 5270 CDS 100% 15.000 21.000 N Casp8ap2 n/a
2 TRCN0000103557 CCCAAGAATGACGTGAAACAT pLKO.1 1210 CDS 100% 5.625 7.875 N Casp8ap2 n/a
3 TRCN0000103556 GCCTCAAATAAGGTGGTTCAT pLKO.1 4885 CDS 100% 4.950 6.930 N Casp8ap2 n/a
4 TRCN0000103559 CGTAAGGATGAAGAGATAAAT pLKO.1 433 CDS 100% 15.000 12.000 N Casp8ap2 n/a
5 TRCN0000317888 CGTAAGGATGAAGAGATAAAT pLKO_005 433 CDS 100% 15.000 12.000 N Casp8ap2 n/a
6 TRCN0000314043 GGCATAGTTGACCGTTTATTT pLKO_005 3337 CDS 100% 15.000 10.500 N Casp8ap2 n/a
7 TRCN0000314093 TTGCTTGTGGCACGGAAATTT pLKO_005 2018 CDS 100% 15.000 10.500 N Casp8ap2 n/a
8 TRCN0000061767 CCAGTCTCTTAAGAAGAATAT pLKO.1 375 CDS 100% 13.200 9.240 N CASP8AP2 n/a
9 TRCN0000314042 GGTCATTGTGCTTGGTGTATT pLKO_005 6114 3UTR 100% 13.200 9.240 N Casp8ap2 n/a
10 TRCN0000103558 CCCAGAGACTTAGTCCCAATT pLKO.1 5570 CDS 100% 10.800 7.560 N Casp8ap2 n/a
11 TRCN0000103555 CCTGTTATTGGTCAGAATGTT pLKO.1 6159 3UTR 100% 5.625 3.938 N Casp8ap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001122978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.