Transcript: Human NM_001127173.3

Homo sapiens cell adhesion molecule 3 (CADM3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CADM3 (57863)
Length:
3739
CDS:
152..1348

Additional Resources:

NCBI RefSeq record:
NM_001127173.3
NBCI Gene record:
CADM3 (57863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057090 CACTACTTGATCCGGCACAAA pLKO.1 1208 CDS 100% 4.950 6.930 N CADM3 n/a
2 TRCN0000057091 CGCATACAGGAAGATCCCAAT pLKO.1 683 CDS 100% 4.050 3.240 N CADM3 n/a
3 TRCN0000412468 GACGACAAGAAGGAATATTTC pLKO_005 1322 CDS 100% 13.200 9.240 N CADM3 n/a
4 TRCN0000433658 GTGAACCATGAATCTCTAAAG pLKO_005 782 CDS 100% 10.800 7.560 N CADM3 n/a
5 TRCN0000057092 CGAGTACACCTGCTCAATCTT pLKO.1 469 CDS 100% 5.625 3.938 N CADM3 n/a
6 TRCN0000057088 CCACCCTAAACTGTCAGTCTT pLKO.1 594 CDS 100% 4.950 3.465 N CADM3 n/a
7 TRCN0000057089 GCCCTTCGAGATAATCGAATT pLKO.1 380 CDS 100% 0.000 0.000 N CADM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08772 pDONR223 100% 99.7% 99.7% None 6G>T;1053T>C;1184A>C n/a
2 ccsbBroad304_08772 pLX_304 0% 99.7% 99.7% V5 6G>T;1053T>C;1184A>C n/a
Download CSV