Transcript: Human NM_001127585.2

Homo sapiens inhibitor of growth family member 4 (ING4), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ING4 (51147)
Length:
1590
CDS:
19..696

Additional Resources:

NCBI RefSeq record:
NM_001127585.2
NBCI Gene record:
ING4 (51147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413825 AGATTGAGTCAAGTGACTATG pLKO_005 290 CDS 100% 10.800 15.120 N ING4 n/a
2 TRCN0000430186 TTAAAGCTCGTGCGCACAAGT pLKO_005 430 CDS 100% 4.950 6.930 N ING4 n/a
3 TRCN0000438249 GCTGAGGTCGGTGCTGTATTT pLKO_005 966 3UTR 100% 13.200 9.240 N ING4 n/a
4 TRCN0000426602 ACAACCCTGATTGTTCCATTG pLKO_005 584 CDS 100% 6.000 4.200 N ING4 n/a
5 TRCN0000103947 CCTATGGCAAGTGCAAGGAAT pLKO.1 158 CDS 100% 4.950 3.465 N Ing4 n/a
6 TRCN0000129395 GAACCCACCTATTGCCTTTGT pLKO.1 529 CDS 100% 4.950 3.465 N ING4 n/a
7 TRCN0000129127 GCTAGGTGTGATCAACACTTT pLKO.1 1090 3UTR 100% 4.950 3.465 N ING4 n/a
8 TRCN0000438065 GCTTGCCATGCAGACCTATGA pLKO_005 198 CDS 100% 4.950 3.465 N ING4 n/a
9 TRCN0000419492 AGGAATTTGGTGACGACAAGG pLKO_005 173 CDS 100% 4.050 2.835 N ING4 n/a
10 TRCN0000439319 AGAAAGCTGCTCGTGCTCGTT pLKO_005 359 CDS 100% 2.640 1.848 N ING4 n/a
11 TRCN0000129334 CAAACAGATCCAGGAAGCCTA pLKO.1 141 CDS 100% 2.640 1.848 N ING4 n/a
12 TRCN0000128673 CGAGAACTTGTAAGTTCTCAA pLKO.1 1440 3UTR 100% 0.495 0.347 N ING4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03228 pDONR223 100% 90.3% 89.9% None 37_38ins72 n/a
2 ccsbBroad304_03228 pLX_304 0% 90.3% 89.9% V5 37_38ins72 n/a
Download CSV