Transcript: Human NM_001127698.2

Homo sapiens serine peptidase inhibitor, Kazal type 5 (SPINK5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SPINK5 (11005)
Length:
3741
CDS:
66..3350

Additional Resources:

NCBI RefSeq record:
NM_001127698.2
NBCI Gene record:
SPINK5 (11005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001127698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435884 GTATTGCCCAGGATAGGTTAT pLKO_005 3147 CDS 100% 10.800 15.120 N SPINK5 n/a
2 TRCN0000422282 GTGTAGTGAATACCGCAAATC pLKO_005 1373 CDS 100% 10.800 15.120 N SPINK5 n/a
3 TRCN0000426822 AGGATACATGTGATGAGTTTA pLKO_005 2377 CDS 100% 13.200 9.240 N SPINK5 n/a
4 TRCN0000073498 CCTACCTTCACCATCTGTATA pLKO.1 3404 3UTR 100% 13.200 9.240 N SPINK5 n/a
5 TRCN0000073501 CGGGTCCCAAATTGGTGTAAA pLKO.1 482 CDS 100% 13.200 9.240 N SPINK5 n/a
6 TRCN0000427840 GCAGGATGCATGGCAACAAAT pLKO_005 817 CDS 100% 13.200 9.240 N SPINK5 n/a
7 TRCN0000427506 TGCAGTGAATATCGTCATTAT pLKO_005 1764 CDS 100% 13.200 9.240 N SPINK5 n/a
8 TRCN0000073499 GCCTTCTTTCAACAAGAAGAA pLKO.1 1488 CDS 100% 0.495 0.347 N SPINK5 n/a
9 TRCN0000073500 CCCTCAAATAATGCAAAGGAT pLKO.1 2787 CDS 100% 3.000 2.100 N SPINK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127698.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.