Transcript: Mouse NM_001128084.2

Mus musculus Rho GTPase activating protein 21 (Arhgap21), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Arhgap21 (71435)
Length:
6974
CDS:
312..6179

Additional Resources:

NCBI RefSeq record:
NM_001128084.2
NBCI Gene record:
Arhgap21 (71435)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001128084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252186 ACGCAGAGAGGTCCATATAAA pLKO_005 2654 CDS 100% 15.000 21.000 N Arhgap21 n/a
2 TRCN0000252184 AGCGGCAATGCCCGTAATATA pLKO_005 897 CDS 100% 15.000 21.000 N Arhgap21 n/a
3 TRCN0000258194 TTACGACACTTCATCGTTTAT pLKO_005 519 CDS 100% 13.200 18.480 N Arhgap21 n/a
4 TRCN0000252187 TTCGGCTGTGAATCGGTTAAA pLKO_005 5798 CDS 100% 13.200 18.480 N Arhgap21 n/a
5 TRCN0000154948 GCACATAGGTTGTCGGACAAT pLKO.1 1529 CDS 100% 4.950 6.930 N ARHGAP21 n/a
6 TRCN0000252185 CCAGAAGAACACACGTATATA pLKO_005 6341 3UTR 100% 15.000 10.500 N Arhgap21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128084.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.