Transcript: Human NM_001128202.3

Homo sapiens testis expressed 36 (TEX36), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
TEX36 (387718)
Length:
941
CDS:
175..735

Additional Resources:

NCBI RefSeq record:
NM_001128202.3
NBCI Gene record:
TEX36 (387718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264117 ACGCTTTCCACGATGCTATAA pLKO_005 597 CDS 100% 13.200 18.480 N TEX36 n/a
2 TRCN0000264116 GGGAGAAGCAAGCAGTGAATA pLKO_005 350 CDS 100% 13.200 9.240 N TEX36 n/a
3 TRCN0000282920 AGATAAGAGGCAACATGTTTC pLKO_005 465 CDS 100% 10.800 7.560 N TEX36 n/a
4 TRCN0000264115 TTTCTTCACTGGAGTCCTAAT pLKO_005 716 CDS 100% 10.800 7.560 N TEX36 n/a
5 TRCN0000264118 TACTGGTATTTCATCAGACAT pLKO_005 768 3UTR 100% 4.950 3.465 N TEX36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05566 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05566 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475620 GACCTCCCGTGGCTGATATGTTTG pLX_317 51.8% 100% 100% V5 n/a
Download CSV