Transcript: Human NM_001128211.1

Homo sapiens NudC domain containing 1 (NUDCD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NUDCD1 (84955)
Length:
3865
CDS:
99..1763

Additional Resources:

NCBI RefSeq record:
NM_001128211.1
NBCI Gene record:
NUDCD1 (84955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330196 GTGTACTCTGTTCGTTGATTA pLKO_005 2093 3UTR 100% 13.200 18.480 N NUDCD1 n/a
2 TRCN0000183000 CCACTGTACTTTACAACAGAA pLKO.1 1591 CDS 100% 4.950 6.930 N NUDCD1 n/a
3 TRCN0000330258 CCACTGTACTTTACAACAGAA pLKO_005 1591 CDS 100% 4.950 6.930 N NUDCD1 n/a
4 TRCN0000148143 GCTTGGAGATTTCCTTGATTA pLKO.1 1039 CDS 100% 13.200 9.240 N NUDCD1 n/a
5 TRCN0000330193 GCTTGGAGATTTCCTTGATTA pLKO_005 1039 CDS 100% 13.200 9.240 N NUDCD1 n/a
6 TRCN0000149900 CACTCCAGCAAACAAGATGAT pLKO.1 1416 CDS 100% 4.950 3.465 N NUDCD1 n/a
7 TRCN0000330194 CACTCCAGCAAACAAGATGAT pLKO_005 1416 CDS 100% 4.950 3.465 N NUDCD1 n/a
8 TRCN0000150191 GCTAGGTAGAAAGTTAGGAAA pLKO.1 3149 3UTR 100% 4.950 3.465 N NUDCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12893 pDONR223 100% 89.1% 88% None (many diffs) n/a
2 ccsbBroad304_12893 pLX_304 0% 89.1% 88% V5 (many diffs) n/a
Download CSV