Transcript: Human NM_001128840.3

Homo sapiens calcium voltage-gated channel subunit alpha1 D (CACNA1D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CACNA1D (776)
Length:
9369
CDS:
557..7042

Additional Resources:

NCBI RefSeq record:
NM_001128840.3
NBCI Gene record:
CACNA1D (776)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236435 ATATCCATGGGTCCTAATAAT pLKO_005 7883 3UTR 100% 15.000 21.000 N CACNA1D n/a
2 TRCN0000236433 GATTATAGCGTATGGATTATT pLKO_005 1093 CDS 100% 15.000 21.000 N CACNA1D n/a
3 TRCN0000044693 GCGTGCTATATCGTGTGATTT pLKO.1 5521 CDS 100% 13.200 18.480 N CACNA1D n/a
4 TRCN0000236434 TTGCCCTACAGGCGGGATTAA pLKO_005 5469 CDS 100% 13.200 18.480 N CACNA1D n/a
5 TRCN0000044696 CCTGCGAAGAACACCACAATT pLKO.1 5450 CDS 100% 13.200 9.240 N CACNA1D n/a
6 TRCN0000236432 GAGATAACAACCAGATCAATA pLKO_005 4689 CDS 100% 13.200 9.240 N CACNA1D n/a
7 TRCN0000236436 TTGGGCCTCCAAGCATATTTC pLKO_005 2285 CDS 100% 13.200 9.240 N CACNA1D n/a
8 TRCN0000044697 CCTGTTGAAGATGACAACTTT pLKO.1 3358 CDS 100% 5.625 3.938 N CACNA1D n/a
9 TRCN0000044695 CCAAGCAAACTGTCCTGTCTT pLKO.1 693 CDS 100% 4.950 3.465 N CACNA1D n/a
10 TRCN0000068878 CCTGCATTAGTATAGTGGAAT pLKO.1 909 CDS 100% 4.950 3.465 N Cacna1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128840.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.