Transcript: Human NM_001128914.1

Homo sapiens poly(rC) binding protein 2 (PCBP2), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
PCBP2 (5094)
Length:
3043
CDS:
351..1307

Additional Resources:

NCBI RefSeq record:
NM_001128914.1
NBCI Gene record:
PCBP2 (5094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001128914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375062 GGCAATGCAACAGTCTCATTT pLKO_005 992 CDS 100% 13.200 10.560 N Pcbp2 n/a
2 TRCN0000336785 GCATTCCACAATCCATCATTG pLKO_005 799 CDS 100% 10.800 7.560 N PCBP2 n/a
3 TRCN0000074684 CCCACTAATGCCATCTTCAAA pLKO.1 540 CDS 100% 5.625 3.938 N PCBP2 n/a
4 TRCN0000327832 CCCACTAATGCCATCTTCAAA pLKO_005 540 CDS 100% 5.625 3.938 N PCBP2 n/a
5 TRCN0000074687 CCTGGCTCAATATCTAATCAA pLKO.1 1244 CDS 100% 5.625 3.938 N PCBP2 n/a
6 TRCN0000327833 CCTGGCTCAATATCTAATCAA pLKO_005 1244 CDS 100% 5.625 3.938 N PCBP2 n/a
7 TRCN0000074683 CCATGATCCATCTGTGTAGTT pLKO.1 1354 3UTR 100% 4.950 3.465 N PCBP2 n/a
8 TRCN0000327906 CCATGATCCATCTGTGTAGTT pLKO_005 1354 3UTR 100% 4.950 3.465 N PCBP2 n/a
9 TRCN0000120929 GCACGTATCAACATCTCAGAA pLKO.1 483 CDS 100% 4.950 3.465 N Pcbp2 n/a
10 TRCN0000328864 GCACGTATCAACATCTCAGAA pLKO_005 483 CDS 100% 4.950 3.465 N Pcbp2 n/a
11 TRCN0000074685 GCCATCACTATTGCTGGCATT pLKO.1 783 CDS 100% 4.050 2.835 N PCBP2 n/a
12 TRCN0000120931 TCCTGAGAGAATTATCACTTT pLKO.1 512 CDS 100% 4.950 2.970 N Pcbp2 n/a
13 TRCN0000328932 TCCTGAGAGAATTATCACTTT pLKO_005 512 CDS 100% 4.950 2.970 N Pcbp2 n/a
14 TRCN0000120930 GCAGCTCTATGACCAATAGTA pLKO.1 601 CDS 100% 5.625 7.875 N Pcbp2 n/a
15 TRCN0000328933 GCAGCTCTATGACCAATAGTA pLKO_005 601 CDS 100% 5.625 7.875 N Pcbp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001128914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.