Transcript: Human NM_001130066.2

Homo sapiens synaptic Ras GTPase activating protein 1 (SYNGAP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SYNGAP1 (8831)
Length:
5966
CDS:
201..4079

Additional Resources:

NCBI RefSeq record:
NM_001130066.2
NBCI Gene record:
SYNGAP1 (8831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156380 CCGGGTAGACAATGTGCTAAA pLKO.1 974 CDS 100% 10.800 15.120 N SYNGAP1 n/a
2 TRCN0000156249 CCCATTCCATGGCTATAGCAA pLKO.1 3089 CDS 100% 3.000 4.200 N SYNGAP1 n/a
3 TRCN0000220018 GAACGGGAGCACCTCATATTC pLKO.1 1632 CDS 100% 13.200 10.560 N SYNGAP1 n/a
4 TRCN0000220019 GGGCCAAATTTATACTTATAT pLKO.1 5527 3UTR 100% 15.000 10.500 N SYNGAP1 n/a
5 TRCN0000154229 CAGTAGCTTTGAGGGTTACAT pLKO.1 2228 CDS 100% 5.625 3.938 N SYNGAP1 n/a
6 TRCN0000154153 CAGAGTATGTCACCAACCATT pLKO.1 1462 CDS 100% 4.950 3.465 N SYNGAP1 n/a
7 TRCN0000152689 GAGGAGATTCACTCACTGAAA pLKO.1 3750 CDS 100% 4.950 3.465 N SYNGAP1 n/a
8 TRCN0000153119 GCACCTCCAAACTTTCAACTT pLKO.1 4548 3UTR 100% 4.950 3.465 N SYNGAP1 n/a
9 TRCN0000157863 CGAACGAAGTCACAACCCAAA pLKO.1 627 CDS 100% 4.050 2.835 N SYNGAP1 n/a
10 TRCN0000157547 GCAGAGTATGTCACCAACCAT pLKO.1 1461 CDS 100% 3.000 2.100 N SYNGAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.