Transcript: Mouse NM_001130152.1

Mus musculus Rho guanine nucleotide exchange factor (GEF) 1 (Arhgef1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Arhgef1 (16801)
Length:
3282
CDS:
171..2933

Additional Resources:

NCBI RefSeq record:
NM_001130152.1
NBCI Gene record:
Arhgef1 (16801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001130152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437366 ACCCTATGCTGAGCGAGTTCA pLKO_005 2062 CDS 100% 4.950 3.465 N ARHGEF1 n/a
2 TRCN0000110050 AGAGGGAGATTGGCTGAACTT pLKO.1 3019 3UTR 100% 4.950 3.465 N Arhgef1 n/a
3 TRCN0000110052 CCTACAGTTAAAGGACATGAT pLKO.1 1820 CDS 100% 4.950 3.465 N Arhgef1 n/a
4 TRCN0000110051 CCTTGACTTCTATCACAGTTT pLKO.1 452 CDS 100% 4.950 3.465 N Arhgef1 n/a
5 TRCN0000110053 CCTGATCTGATCTCTGAGGAT pLKO.1 543 CDS 100% 2.640 1.848 N Arhgef1 n/a
6 TRCN0000110054 GTGACCAAAGACAAAGCTATA pLKO.1 2139 CDS 100% 10.800 6.480 N Arhgef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130152.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15657 pDONR223 0% 82.1% 84.1% None (many diffs) n/a
2 ccsbBroad304_15657 pLX_304 0% 82.1% 84.1% V5 (many diffs) n/a
Download CSV