Transcript: Human NM_001130929.2

Homo sapiens short transmembrane mitochondrial protein 1 (STMP1), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
STMP1 (647087)
Length:
2461
CDS:
67..210

Additional Resources:

NCBI RefSeq record:
NM_001130929.2
NBCI Gene record:
STMP1 (647087)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256820 CCAGTTCCTGCTTGGATTTAC pLKO_005 72 CDS 100% 13.200 9.240 N STMP1 n/a
2 TRCN0000256823 AGGACTTGGATGCCAAGAAGA pLKO_005 173 CDS 100% 4.950 3.465 N STMP1 n/a
3 TRCN0000256824 TGGGCAACGTGGTTGGAATGT pLKO_005 95 CDS 100% 4.950 3.465 N STMP1 n/a
4 TRCN0000256822 TTATGGTGCTAGATTAGTAAA pLKO_005 458 3UTR 100% 13.200 7.920 N STMP1 n/a
5 TRCN0000256821 TCTGGCTCAGAACTATGATAT pLKO_005 117 CDS 100% 13.200 6.600 Y STMP1 n/a
6 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2213 3UTR 100% 1.080 0.540 Y GPR83 n/a
7 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2213 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.