Transcript: Human NM_001130986.2

Homo sapiens dysferlin (DYSF), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DYSF (8291)
Length:
6619
CDS:
145..6348

Additional Resources:

NCBI RefSeq record:
NM_001130986.2
NBCI Gene record:
DYSF (8291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420631 AGATGTGGGTCGACCTATTTC pLKO_005 5456 CDS 100% 13.200 18.480 N DYSF n/a
2 TRCN0000424151 ACCTATGAGAACGAGACTAAG pLKO_005 2746 CDS 100% 10.800 15.120 N DYSF n/a
3 TRCN0000000967 CCTGCGTTGTATTATCTGGAA pLKO.1 5541 CDS 100% 2.640 2.112 N DYSF n/a
4 TRCN0000418266 CACCGTCAAGGTCATCGATAA pLKO_005 4308 CDS 100% 10.800 7.560 N DYSF n/a
5 TRCN0000000964 CCGTGTAATGTTTCAGGATAA pLKO.1 5262 CDS 100% 10.800 7.560 N DYSF n/a
6 TRCN0000000963 GATCAGCTCAGACATATTTCA pLKO.1 6577 3UTR 100% 5.625 3.938 N DYSF n/a
7 TRCN0000000966 CCCTGCTGAGAAGATGTACTA pLKO.1 3189 CDS 100% 4.950 3.465 N DYSF n/a
8 TRCN0000000965 GCTGGAAATGACCTTGGAGAT pLKO.1 6057 CDS 100% 4.050 2.835 N DYSF n/a
9 TRCN0000141633 CTCTTCATCCTGCTGCTGTTT pLKO.1 6262 CDS 100% 4.950 2.475 Y CEP170P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.