Transcript: Human NM_001134451.2

Homo sapiens transmembrane protein 130 (TMEM130), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TMEM130 (222865)
Length:
2685
CDS:
154..1119

Additional Resources:

NCBI RefSeq record:
NM_001134451.2
NBCI Gene record:
TMEM130 (222865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005357 CCGTGGTCTATTATAACTATT pLKO.1 422 CDS 100% 13.200 18.480 N TMEM130 n/a
2 TRCN0000005356 GCAGGACTAATACTGAGTGAT pLKO.1 1899 3UTR 100% 4.950 6.930 N TMEM130 n/a
3 TRCN0000433986 GAGCTAGAAAGAAGGTCATAA pLKO_005 1535 3UTR 100% 13.200 9.240 N TMEM130 n/a
4 TRCN0000422004 TCACTAAGACCGTCCTGAAAG pLKO_005 302 CDS 100% 10.800 7.560 N TMEM130 n/a
5 TRCN0000433710 TGTACATGACCCTGCGGAATG pLKO_005 920 CDS 100% 6.000 4.200 N TMEM130 n/a
6 TRCN0000005358 CCTGGAAATTGTTCGTGAGAA pLKO.1 1047 CDS 100% 4.950 3.465 N TMEM130 n/a
7 TRCN0000005360 CTTTCCCATGTGCTACACTTA pLKO.1 875 CDS 100% 4.950 3.465 N TMEM130 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2038 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2039 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1633 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.