Transcript: Human NM_001134773.3

Homo sapiens syntaxin 16 (STX16), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
STX16 (8675)
Length:
4886
CDS:
725..1651

Additional Resources:

NCBI RefSeq record:
NM_001134773.3
NBCI Gene record:
STX16 (8675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001134773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219995 CTAATTGAGAGAGCGTTATTT pLKO.1 4600 3UTR 100% 15.000 21.000 N STX16 n/a
2 TRCN0000219994 CATCGTTTACCTACCTATTAT pLKO.1 2834 3UTR 100% 15.000 10.500 N STX16 n/a
3 TRCN0000229992 CATCGTTTACCTACCTATTAT pLKO_005 2834 3UTR 100% 15.000 10.500 N STX16 n/a
4 TRCN0000218212 ATCGGAAGATGCTTGTGATTT pLKO_005 1569 CDS 100% 13.200 9.240 N STX16 n/a
5 TRCN0000161981 GAATCGGAAGATGCTTGTGAT pLKO.1 1567 CDS 100% 4.950 3.465 N STX16 n/a
6 TRCN0000218044 TTCTTGTTGTTGCGGAATAAT pLKO_005 752 CDS 100% 15.000 7.500 Y STX16 n/a
7 TRCN0000218497 AGGAACATGCCATTGAGATAA pLKO_005 1026 CDS 100% 13.200 6.600 Y STX16 n/a
8 TRCN0000229991 GTATGATGTTGGCCGGATTAA pLKO_005 931 CDS 100% 13.200 6.600 Y STX16 n/a
9 TRCN0000166416 CGAGAGATTCGCCAGATTGTA pLKO.1 1385 CDS 100% 5.625 2.813 Y STX16 n/a
10 TRCN0000162176 CGTTGAACAGTCCTGTATCAA pLKO.1 1495 CDS 100% 5.625 2.813 Y STX16 n/a
11 TRCN0000159935 GTGGATGAAATTCAGTATGAT pLKO.1 917 CDS 100% 5.625 2.813 Y STX16 n/a
12 TRCN0000162031 CGATGATTGTAGAACAGGGTA pLKO.1 1449 CDS 100% 2.640 1.320 Y STX16 n/a
13 TRCN0000166215 CGCATGAAGAATCGAGAGGAA pLKO.1 1229 CDS 100% 2.640 1.320 Y STX16 n/a
14 TRCN0000161930 GCCATTGAGATAACTACCCAA pLKO.1 1034 CDS 100% 2.640 1.320 Y STX16 n/a
15 TRCN0000165099 CCAAGAGATCACTCAGCTCTT pLKO.1 1051 CDS 100% 0.405 0.203 Y STX16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001134773.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.