Transcript: Human NM_001135699.1

Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
YWHAZ (7534)
Length:
3020
CDS:
156..893

Additional Resources:

NCBI RefSeq record:
NM_001135699.1
NBCI Gene record:
YWHAZ (7534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029405 GCAATTACTGAGAGACAACTT pLKO.1 809 CDS 100% 4.950 3.960 N YWHAZ n/a
2 TRCN0000292168 GCAATTACTGAGAGACAACTT pLKO_005 809 CDS 100% 4.950 3.960 N YWHAZ n/a
3 TRCN0000029404 GCAGAGAGCAAAGTCTTCTAT pLKO.1 489 CDS 100% 5.625 3.938 N YWHAZ n/a
4 TRCN0000292167 GCAGAGAGCAAAGTCTTCTAT pLKO_005 489 CDS 100% 5.625 3.938 N YWHAZ n/a
5 TRCN0000029408 CTCTGTGTTCTATTATGAGAT pLKO.1 677 CDS 100% 4.950 3.465 N YWHAZ n/a
6 TRCN0000292170 CTCTGTGTTCTATTATGAGAT pLKO_005 677 CDS 100% 4.950 3.465 N YWHAZ n/a
7 TRCN0000029407 GAGAGGAATCTTCTCTCAGTT pLKO.1 273 CDS 100% 0.495 0.347 N YWHAZ n/a
8 TRCN0000029406 GCTCGAGAATACAGAGAGAAA pLKO.1 390 CDS 100% 0.000 0.000 N YWHAZ n/a
9 TRCN0000292169 GCTCGAGAATACAGAGAGAAA pLKO_005 390 CDS 100% 0.000 0.000 N YWHAZ n/a
10 TRCN0000071053 CCATTGCTGAACTTGATACAT pLKO.1 751 CDS 100% 5.625 2.813 Y Ywhaz n/a
11 TRCN0000316383 CCATTGCTGAACTTGATACAT pLKO_005 751 CDS 100% 5.625 2.813 Y Ywhaz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.