Transcript: Human NM_001136191.3

Homo sapiens KN motif and ankyrin repeat domains 2 (KANK2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
KANK2 (25959)
Length:
5183
CDS:
340..2895

Additional Resources:

NCBI RefSeq record:
NM_001136191.3
NBCI Gene record:
KANK2 (25959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423384 AGATTGCGTCCATGCTGTATT pLKO_005 2798 CDS 100% 13.200 10.560 N KANK2 n/a
2 TRCN0000152599 GATGTCAACGTGCAAGATGAT pLKO.1 2629 CDS 100% 4.950 3.465 N KANK2 n/a
3 TRCN0000153784 CATGAACATCAAGTGCTCGTT pLKO.1 2823 CDS 100% 2.640 1.848 N KANK2 n/a
4 TRCN0000155303 GCTTGGCAACATCAATGCCAA pLKO.1 2520 CDS 100% 0.264 0.185 N KANK2 n/a
5 TRCN0000155948 CCTCAAGTACGTGGATGACAT pLKO.1 477 CDS 100% 4.950 2.970 N KANK2 n/a
6 TRCN0000155100 GCAGATGTCAACGTGCAAGAT pLKO.1 2626 CDS 100% 4.950 2.970 N KANK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136191.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.