Transcript: Human NM_001136197.1

Homo sapiens fizzy and cell division cycle 20 related 1 (FZR1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
FZR1 (51343)
Length:
3170
CDS:
35..1249

Additional Resources:

NCBI RefSeq record:
NM_001136197.1
NBCI Gene record:
FZR1 (51343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231905 GGATCCTGGAGTCTCATTAAA pLKO_005 1385 3UTR 100% 15.000 21.000 N FZR1 n/a
2 TRCN0000231903 TGAGGTTCTGGAACGTCTTTA pLKO_005 1167 CDS 100% 13.200 18.480 N FZR1 n/a
3 TRCN0000231904 CTTCACCAGGATCCGGTAAAC pLKO_005 1231 CDS 100% 10.800 8.640 N FZR1 n/a
4 TRCN0000231901 GTGAACTTCCACAGGATTAAC pLKO_005 209 CDS 100% 13.200 9.240 N FZR1 n/a
5 TRCN0000004162 CCAGCCTTGTTTCTCATGTAA pLKO.1 3110 3UTR 100% 5.625 3.938 N FZR1 n/a
6 TRCN0000010857 CCAGTCAGAACCGGAAAGCCA pLKO.1 246 CDS 100% 0.250 0.175 N FZR1 n/a
7 TRCN0000010855 CAACGACAACAAGCTGCTGGT pLKO.1 763 CDS 100% 2.160 1.296 N FZR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136197.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03287 pDONR223 100% 81.9% 81.9% None 386_387ins267 n/a
2 ccsbBroad304_03287 pLX_304 0% 81.9% 81.9% V5 386_387ins267 n/a
Download CSV