Transcript: Human NM_001137549.1

Homo sapiens family with sequence similarity 25 member G (FAM25G), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
FAM25G (100133093)
Length:
335
CDS:
27..296

Additional Resources:

NCBI RefSeq record:
NM_001137549.1
NBCI Gene record:
FAM25G (100133093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001137549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284147 GCCATTGCTGAAGCCATAAAG pLKO_005 162 CDS 100% 13.200 6.600 Y FAM25BP n/a
2 TRCN0000284138 CCAAGGAGACTGGAGAGAAAG pLKO_005 142 CDS 100% 10.800 5.400 Y FAM25G n/a
3 TRCN0000269694 AGACTGGAGAGAAAGCCATTG pLKO_005 148 CDS 100% 6.000 3.000 Y FAM25C n/a
4 TRCN0000269862 CATTGCTGAAGCCATAAAGAA pLKO_005 164 CDS 100% 5.625 2.813 Y FAM25G n/a
5 TRCN0000284061 CCATTGCTGAAGCCATAAAGA pLKO_005 163 CDS 100% 5.625 2.813 Y FAM25C n/a
6 TRCN0000269695 CATTCATGCCGTGGAGGAAGT pLKO_005 98 CDS 100% 4.050 2.025 Y FAM25C n/a
7 TRCN0000269905 GGAGAGAAAGCCATTGCTGAA pLKO_005 153 CDS 100% 4.050 2.025 Y FAM25G n/a
8 TRCN0000284144 ACTGGAGAGAAAGCCATTGCT pLKO_005 150 CDS 100% 3.000 1.500 Y FAM25BP n/a
9 TRCN0000269693 ACATGCCAAGGAGACTGGAGA pLKO_005 137 CDS 100% 2.640 1.320 Y FAM25C n/a
10 TRCN0000269915 ATGCCAAGGAGACTGGAGAGA pLKO_005 139 CDS 100% 2.640 1.320 Y FAM25BP n/a
11 TRCN0000284058 GTGAAGGAGGTGGTGGGACAT pLKO_005 120 CDS 100% 1.350 0.675 Y FAM25C n/a
12 TRCN0000284136 TGCCGTGGAGGAAGTGGTGAA pLKO_005 104 CDS 100% 1.350 0.675 Y FAM25G n/a
13 TRCN0000284142 ATGCCGTGGAGGAAGTGGTGA pLKO_005 103 CDS 100% 0.880 0.440 Y FAM25BP n/a
14 TRCN0000284140 GAAGTGGTGAAGGAGGTGGTG pLKO_005 114 CDS 100% 0.720 0.360 Y FAM25BP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001137549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05716 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05716 pLX_304 0% 100% 100% V5 n/a
Download CSV