Transcript: Mouse NM_001141949.1

Mus musculus N-myc (and STAT) interactor (Nmi), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Nmi (64685)
Length:
1368
CDS:
347..1291

Additional Resources:

NCBI RefSeq record:
NM_001141949.1
NBCI Gene record:
Nmi (64685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001141949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100979 CCACTTCCAACGGAAGAATAA pLKO.1 1183 CDS 100% 13.200 9.240 N Nmi n/a
2 TRCN0000234061 CTGGCGTTGTTGACAAGATTT pLKO_005 978 CDS 100% 13.200 9.240 N Nmi n/a
3 TRCN0000218598 CTTTCAAGTGAGCTCACAAAT pLKO_005 616 CDS 100% 13.200 9.240 N Nmi n/a
4 TRCN0000234062 ACAGTGCTTCTGACCGGATTA pLKO_005 1115 CDS 100% 10.800 7.560 N Nmi n/a
5 TRCN0000100976 CGAAGTGGAAAGCGTGGATTA pLKO.1 916 CDS 100% 10.800 7.560 N Nmi n/a
6 TRCN0000234059 CTCAGCAGAGATGGACGATAT pLKO_005 391 CDS 100% 10.800 7.560 N Nmi n/a
7 TRCN0000100975 CCATGTATAGAACGATGCTTA pLKO.1 1058 CDS 100% 4.950 3.465 N Nmi n/a
8 TRCN0000100978 CGGATGCCAGAGAATTCCAAA pLKO.1 507 CDS 100% 0.000 0.000 N Nmi n/a
9 TRCN0000325052 CGGATGCCAGAGAATTCCAAA pLKO_005 507 CDS 100% 0.000 0.000 N Nmi n/a
10 TRCN0000100977 GAAGTGGAAAGCGTGGATTAT pLKO.1 917 CDS 100% 13.200 7.920 N Nmi n/a
11 TRCN0000234060 GAAGTGGAAAGCGTGGATTAT pLKO_005 917 CDS 100% 13.200 7.920 N Nmi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001141949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.