Transcript: Human NM_001142444.3

Homo sapiens enhancer of mRNA decapping 3 (EDC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
EDC3 (80153)
Length:
3833
CDS:
253..1779

Additional Resources:

NCBI RefSeq record:
NM_001142444.3
NBCI Gene record:
EDC3 (80153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275788 GCCTGGTTGTCCCAAGTATTT pLKO_005 1079 CDS 100% 13.200 18.480 N EDC3 n/a
2 TRCN0000162448 CAACAAGTGTCTAGCCTCAAA pLKO.1 1423 CDS 100% 4.950 6.930 N EDC3 n/a
3 TRCN0000160640 CGTATCTATTTGTGCGACATT pLKO.1 1669 CDS 100% 4.950 6.930 N EDC3 n/a
4 TRCN0000162247 CCGTATCTATTTGTGCGACAT pLKO.1 1668 CDS 100% 4.050 5.670 N EDC3 n/a
5 TRCN0000160705 CCTAACAGGTTGAATCCCAAA pLKO.1 1219 CDS 100% 4.050 5.670 N EDC3 n/a
6 TRCN0000161648 GTGTCCATCAATTGTGGAGAT pLKO.1 280 CDS 100% 4.050 3.240 N EDC3 n/a
7 TRCN0000285429 GGCCTGTACCTGCTCTATTTC pLKO_005 2147 3UTR 100% 13.200 9.240 N EDC3 n/a
8 TRCN0000159171 GCACAGGTAGTATAAGGTTAT pLKO.1 2489 3UTR 100% 10.800 7.560 N EDC3 n/a
9 TRCN0000160952 GCTGTGTTTGAGGAGATTGAT pLKO.1 901 CDS 100% 5.625 3.938 N EDC3 n/a
10 TRCN0000275790 GCTGTGTTTGAGGAGATTGAT pLKO_005 901 CDS 100% 5.625 3.938 N EDC3 n/a
11 TRCN0000165040 GCAGCTCTCAAGACTGTGTTT pLKO.1 2065 3UTR 100% 4.950 3.465 N EDC3 n/a
12 TRCN0000165761 CCAACAAGTGTCTAGCCTCAA pLKO.1 1422 CDS 100% 4.050 2.835 N EDC3 n/a
13 TRCN0000275789 CCAACAAGTGTCTAGCCTCAA pLKO_005 1422 CDS 100% 4.050 2.835 N EDC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142444.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04178 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04178 pLX_304 0% 100% 100% V5 n/a
Download CSV