Transcript: Human NM_001142469.1

Homo sapiens bMERB domain containing 1 (BMERB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
BMERB1 (89927)
Length:
2053
CDS:
57..620

Additional Resources:

NCBI RefSeq record:
NM_001142469.1
NBCI Gene record:
BMERB1 (89927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152285 CCCGTGTAATTCATGTACATT pLKO.1 1591 3UTR 100% 5.625 7.875 N BMERB1 n/a
2 TRCN0000155109 GCAGAGAGAGGATGAGCTAAT pLKO.1 335 CDS 100% 10.800 7.560 N BMERB1 n/a
3 TRCN0000153752 CAAGGACATCATGGACTTGAA pLKO.1 257 CDS 100% 4.950 3.465 N BMERB1 n/a
4 TRCN0000152026 CCTCTAGACAAAGTAACCAAA pLKO.1 477 CDS 100% 4.950 3.465 N BMERB1 n/a
5 TRCN0000155741 CGGTTAAGGGAGCAAGAAGAA pLKO.1 417 CDS 100% 4.950 3.465 N BMERB1 n/a
6 TRCN0000155312 GCCTGTGTGACTTCTCTGTAT pLKO.1 1633 3UTR 100% 4.950 3.465 N BMERB1 n/a
7 TRCN0000154918 GATTGAGCTGGAGATGGCAAA pLKO.1 161 CDS 100% 4.050 2.835 N BMERB1 n/a
8 TRCN0000153134 GCTAATCCAGAAGATCCACAA pLKO.1 350 CDS 100% 4.050 2.835 N BMERB1 n/a
9 TRCN0000152752 GAGCAAGAAGAAGACAAGGAA pLKO.1 426 CDS 100% 3.000 2.100 N BMERB1 n/a
10 TRCN0000114404 AGGTTCATGATGGATGACATT pLKO.1 228 CDS 100% 4.950 3.465 N Bmerb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04498 pDONR223 100% 88.1% 83.9% None (many diffs) n/a
2 ccsbBroad304_04498 pLX_304 0% 88.1% 83.9% V5 (many diffs) n/a
Download CSV