Transcript: Human NM_001142534.1

Homo sapiens SH2 domain containing 3C (SH2D3C), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SH2D3C (10044)
Length:
2666
CDS:
124..2226

Additional Resources:

NCBI RefSeq record:
NM_001142534.1
NBCI Gene record:
SH2D3C (10044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427529 GCGCTATGAGAAGTTCGACAA pLKO_005 2148 CDS 100% 4.050 5.670 N SH2D3C n/a
2 TRCN0000420161 ACTGTGATCAACCCGAGAATG pLKO_005 2310 3UTR 100% 10.800 7.560 N SH2D3C n/a
3 TRCN0000072863 CCATCGTGGAAGTCACTTCTT pLKO.1 1277 CDS 100% 4.950 3.465 N SH2D3C n/a
4 TRCN0000426643 CCTTGCACTTCAAGATCAACA pLKO_005 428 CDS 100% 4.950 3.465 N SH2D3C n/a
5 TRCN0000072867 CACACACATCCAGTACCTGTT pLKO.1 477 CDS 100% 4.050 2.835 N SH2D3C n/a
6 TRCN0000072864 CCAGAGAAACTCCACAAGGAA pLKO.1 232 CDS 100% 3.000 2.100 N SH2D3C n/a
7 TRCN0000072865 CCTGGACTCATCGCCAGAGAA pLKO.1 219 CDS 100% 1.650 1.155 N SH2D3C n/a
8 TRCN0000072866 GCGCTGCTGCACAAGACCATT pLKO.1 1630 CDS 100% 1.650 1.155 N SH2D3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07536 pDONR223 100% 97.3% 96.7% None (many diffs) n/a
Download CSV