Transcript: Human NM_001142733.3

Homo sapiens ankyrin repeat and SOCS box containing 14 (ASB14), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ASB14 (142686)
Length:
3187
CDS:
125..1888

Additional Resources:

NCBI RefSeq record:
NM_001142733.3
NBCI Gene record:
ASB14 (142686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415977 TACGGATCTTGCTGCCATTAA pLKO_005 1036 CDS 100% 13.200 18.480 N ASB14 n/a
2 TRCN0000438168 GCCGCCTAAAGATCCGGAAAT pLKO_005 1737 CDS 100% 10.800 15.120 N ASB14 n/a
3 TRCN0000152228 CGAGTGATGCTTGATTATGTT pLKO.1 1610 CDS 100% 5.625 7.875 N ASB14 n/a
4 TRCN0000151520 CTGGACATCTACAGTTATCAA pLKO.1 1525 CDS 100% 5.625 7.875 N ASB14 n/a
5 TRCN0000428114 TCCATTACCCAATCGTCTAAA pLKO_005 1804 CDS 100% 13.200 9.240 N ASB14 n/a
6 TRCN0000151317 GCCCTTCATTTGGAAATTCAA pLKO.1 2949 3UTR 100% 5.625 3.938 N ASB14 n/a
7 TRCN0000153587 GCACTGCAATACACTCTGAAA pLKO.1 1400 CDS 100% 4.950 3.465 N ASB14 n/a
8 TRCN0000151256 GCTCTAAAGATACTGATTCCA pLKO.1 1013 CDS 100% 3.000 2.100 N ASB14 n/a
9 TRCN0000154755 GATGCTGCTGAACTATGGGTA pLKO.1 1438 CDS 100% 2.640 1.848 N ASB14 n/a
10 TRCN0000152088 CCTTTACAAAGAATACGACCT pLKO.1 1834 CDS 100% 2.160 1.512 N ASB14 n/a
11 TRCN0000103956 GCTGGACATCTACAGTTATTA pLKO.1 1524 CDS 100% 15.000 21.000 N Asb14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13212 pDONR223 100% 35.6% 31.5% None (many diffs) n/a
2 ccsbBroad304_13212 pLX_304 0% 35.6% 31.5% V5 (many diffs) n/a
Download CSV