Transcript: Mouse NM_001142963.1

Mus musculus predicted gene 10778 (Gm10778), mRNA.

Source:
NCBI, updated 2017-05-05
Taxon:
Mus musculus (mouse)
Gene:
Gm10778 (100233208)
Length:
4747
CDS:
96..1595

Additional Resources:

NCBI RefSeq record:
NM_001142963.1
NBCI Gene record:
Gm10778 (100233208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235191 ACTGGAGAGAAACCATATAAA pLKO_005 1398 CDS 100% 15.000 7.500 Y Gm4767 n/a
2 TRCN0000235210 ACTGGAGAGAAACCATATAAA pLKO_005 1398 CDS 100% 15.000 7.500 Y EG666477 n/a
3 TRCN0000239111 ATAGAGGAACACACGATATTT pLKO_005 2090 3UTR 100% 15.000 7.500 Y Gm4767 n/a
4 TRCN0000235193 CCTTGAACACCAAGCATATTT pLKO_005 1760 3UTR 100% 15.000 7.500 Y Gm4767 n/a
5 TRCN0000239113 AGAGGATGTGGAAGGTATAAC pLKO_005 273 CDS 100% 13.200 6.600 Y Gm4767 n/a
6 TRCN0000235192 GCCTTTGCATATCGCAGTAAT pLKO_005 1437 CDS 100% 13.200 6.600 Y Gm4767 n/a
7 TRCN0000235211 GCCTTTGCATATCGCAGTAAT pLKO_005 1437 CDS 100% 13.200 6.600 Y EG666477 n/a
8 TRCN0000235189 AGTCGTAGTAGTCTTCGAAAT pLKO_005 858 CDS 100% 10.800 5.400 Y Gm4767 n/a
9 TRCN0000235208 AGTCGTAGTAGTCTTCGAAAT pLKO_005 858 CDS 100% 10.800 5.400 Y EG666477 n/a
10 TRCN0000235190 AGTCGTCGTTATCTTCGAAAT pLKO_005 1278 CDS 100% 10.800 5.400 Y Gm4767 n/a
11 TRCN0000235209 AGTCGTCGTTATCTTCGAAAT pLKO_005 1278 CDS 100% 10.800 5.400 Y EG666477 n/a
12 TRCN0000243549 CCCAGAAGAGTCTCTACAAAG pLKO_005 166 CDS 100% 10.800 5.400 Y Gm9222 n/a
13 TRCN0000175115 GAATGTAATCAGTGTGGTAAA pLKO.1 1080 CDS 100% 10.800 5.400 Y Zfp935 n/a
14 TRCN0000239109 GTCGTCGTTATCTTCGAAATC pLKO_005 1279 CDS 100% 10.800 5.400 Y Gm4767 n/a
15 TRCN0000093238 GAGTCTCTACAAAGATGTGAT pLKO.1 173 CDS 100% 4.950 2.475 Y Gm4983 n/a
16 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1064 CDS 100% 13.200 6.600 Y Zfp977 n/a
17 TRCN0000086605 CCGGAGAGAAACCCTATGAAT pLKO.1 643 CDS 100% 5.625 2.813 Y Zfp933 n/a
18 TRCN0000427014 ACCGGAGAGAAACCCTATGAG pLKO_005 642 CDS 100% 4.950 2.475 Y Zfp647 n/a
19 TRCN0000193310 CCTATGAATGTAATCAGTGTA pLKO.1 1075 CDS 100% 4.950 2.475 Y Zfp932 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.