Transcript: Mouse NM_001143802.1

Mus musculus family with sequence similarity 196, member A (Fam196a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam196a (627214)
Length:
4637
CDS:
725..2137

Additional Resources:

NCBI RefSeq record:
NM_001143802.1
NBCI Gene record:
Fam196a (627214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001143802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347521 GGGTGGCCTATCGTAAGTATA pLKO_005 966 CDS 100% 13.200 18.480 N Fam196a n/a
2 TRCN0000347523 ACCCACGGAAGGGTGTTTAAA pLKO_005 1451 CDS 100% 15.000 12.000 N Fam196a n/a
3 TRCN0000347601 ACAGTAGAACTTCTCATTATT pLKO_005 2484 3UTR 100% 15.000 10.500 N Fam196a n/a
4 TRCN0000284012 CATCGGGAAGGGCTTTCATAT pLKO_005 1871 CDS 100% 13.200 9.240 N INSYN2A n/a
5 TRCN0000347626 CATCGGGAAGGGCTTTCATAT pLKO_005 1871 CDS 100% 13.200 9.240 N Fam196a n/a
6 TRCN0000347602 TGCAGGTGATGGAGAACTTAA pLKO_005 1782 CDS 100% 13.200 9.240 N Fam196a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10187 pDONR223 100% 81.5% 83.9% None (many diffs) n/a
2 ccsbBroad304_10187 pLX_304 0% 81.5% 83.9% V5 (many diffs) n/a
3 TRCN0000478132 GAACACGAATGGATGCGCCGATAC pLX_317 30.4% 81.5% 83.9% V5 (many diffs) n/a
Download CSV