Transcript: Human NM_001143962.2

Homo sapiens calpain 8 (CAPN8), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
CAPN8 (388743)
Length:
2387
CDS:
56..2167

Additional Resources:

NCBI RefSeq record:
NM_001143962.2
NBCI Gene record:
CAPN8 (388743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352323 GGAGACCCTCTTCAAACTATT pLKO_005 2071 CDS 100% 13.200 18.480 N CAPN8 n/a
2 TRCN0000352324 TCTATTGGGAAACTGATTATA pLKO_005 1893 CDS 100% 15.000 12.000 N CAPN8 n/a
3 TRCN0000370720 GCCAAGCTTAATGGTTGTTAT pLKO_005 611 CDS 100% 13.200 10.560 N CAPN8 n/a
4 TRCN0000352440 ATGCGGGAATCTTTCACTTTC pLKO_005 459 CDS 100% 10.800 7.560 N CAPN8 n/a
5 TRCN0000377606 CCACTGCTTGCTTCTTGTCAC pLKO_005 2202 3UTR 100% 4.050 2.835 N CAPN8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10096 pDONR223 100% 99.9% 99.7% None 734C>A;1775C>T n/a
2 ccsbBroad304_10096 pLX_304 0% 99.9% 99.7% V5 734C>A;1775C>T n/a
3 TRCN0000478113 CACCGTATCTTCTGGCCACGATAA pLX_317 20.5% 99.9% 99.7% V5 734C>A;1775C>T n/a
Download CSV