Transcript: Human NM_001143984.1

Homo sapiens protein tyrosine phosphatase mitochondrial 1 (PTPMT1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-04-09
Taxon:
Homo sapiens (human)
Gene:
PTPMT1 (114971)
Length:
2568
CDS:
194..649

Additional Resources:

NCBI RefSeq record:
NM_001143984.1
NBCI Gene record:
PTPMT1 (114971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052687 CGAGACGAGGTTCCTGTGCAA pLKO.1 527 CDS 100% 0.880 0.704 N PTPMT1 n/a
2 TRCN0000289104 CGAGACGAGGTTCCTGTGCAA pLKO_005 527 CDS 100% 0.880 0.704 N PTPMT1 n/a
3 TRCN0000052683 GCTGGATGTTCTTAAAGAGTT pLKO.1 635 CDS 100% 4.950 3.465 N PTPMT1 n/a
4 TRCN0000174256 GCTGGATGTTCTTAAAGAGTT pLKO.1 635 CDS 100% 4.950 3.465 N PTPMT1 n/a
5 TRCN0000289105 GCTGGATGTTCTTAAAGAGTT pLKO_005 635 CDS 100% 4.950 3.465 N PTPMT1 n/a
6 TRCN0000052685 GATCCGGTCATACATCCACAT pLKO.1 602 CDS 100% 4.050 2.835 N PTPMT1 n/a
7 TRCN0000289102 GATCCGGTCATACATCCACAT pLKO_005 602 CDS 100% 4.050 2.835 N PTPMT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143984.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.