Transcript: Human NM_001145006.1

Homo sapiens mucin 7, secreted (MUC7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
MUC7 (4589)
Length:
2565
CDS:
289..1422

Additional Resources:

NCBI RefSeq record:
NM_001145006.1
NBCI Gene record:
MUC7 (4589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083741 CGGTCACTACTCAAACTACTA pLKO.1 1295 CDS 100% 4.950 6.930 N MUC7 n/a
2 TRCN0000083742 GCCGTTCATTAGAAAGTCCTA pLKO.1 456 CDS 100% 2.640 3.696 N MUC7 n/a
3 TRCN0000373025 GCTTCCACCTTCACCTAATAA pLKO_005 507 CDS 100% 15.000 12.000 N MUC7 n/a
4 TRCN0000373077 ACCACCACAAGACCTATTAAC pLKO_005 1570 3UTR 100% 13.200 9.240 N MUC7 n/a
5 TRCN0000373076 CACTTTGAATTACCACATTAT pLKO_005 412 CDS 100% 13.200 9.240 N MUC7 n/a
6 TRCN0000083740 GCCACCTAAACATCCAGATAA pLKO.1 555 CDS 100% 13.200 9.240 N MUC7 n/a
7 TRCN0000083738 GCCTCTGTGAACAACAAGAAT pLKO.1 2168 3UTR 100% 5.625 3.938 N MUC7 n/a
8 TRCN0000083739 CCACCATATCTTCAAGAGAAA pLKO.1 698 CDS 100% 4.950 3.465 N MUC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06604 pDONR223 100% 99.9% 99.7% None 1001C>T n/a
2 ccsbBroad304_06604 pLX_304 0% 99.9% 99.7% V5 1001C>T n/a
Download CSV