Transcript: Human NM_001145132.2

Homo sapiens chromosome 5 open reading frame 52 (C5orf52), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C5orf52 (100190949)
Length:
721
CDS:
83..562

Additional Resources:

NCBI RefSeq record:
NM_001145132.2
NBCI Gene record:
C5orf52 (100190949)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177995 GCCATTTATCTCGGGTGATTA pLKO.1 342 CDS 100% 13.200 18.480 N 4921536K21Rik n/a
2 TRCN0000344470 GCCATTTATCTCGGGTGATTA pLKO_005 342 CDS 100% 13.200 18.480 N C5orf52 n/a
3 TRCN0000353058 GCCGGTGCTGTTCAGCTTAAT pLKO_005 280 CDS 100% 13.200 18.480 N C5orf52 n/a
4 TRCN0000344472 TGAACAGCAACCGGTACTTAA pLKO_005 516 CDS 100% 13.200 18.480 N C5orf52 n/a
5 TRCN0000344471 GCATCACACAACGAATCTATG pLKO_005 375 CDS 100% 10.800 8.640 N C5orf52 n/a
6 TRCN0000344408 GGATACCACCACCAGTTTAAA pLKO_005 543 CDS 100% 15.000 10.500 N C5orf52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.