Transcript: Human NM_001145783.2

Homo sapiens BLOC-1 related complex subunit 8 (BORCS8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
BORCS8 (729991)
Length:
1058
CDS:
36..365

Additional Resources:

NCBI RefSeq record:
NM_001145783.2
NBCI Gene record:
BORCS8 (729991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145783.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10202 pDONR223 100% 91% 90.7% None 81G>A;327_327delGins31 n/a
2 ccsbBroad304_10202 pLX_304 0% 91% 90.7% V5 81G>A;327_327delGins31 n/a
3 TRCN0000491305 GCGGGACACACGCACGAGTTCCTT pLX_317 90.1% 91% 90.7% V5 81G>A;327_327delGins31 n/a
Download CSV