Transcript: Human NM_001145809.2

Homo sapiens myosin heavy chain 14 (MYH14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MYH14 (79784)
Length:
6914
CDS:
54..6164

Additional Resources:

NCBI RefSeq record:
NM_001145809.2
NBCI Gene record:
MYH14 (79784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149679 GTTTGGCAACATTGCCTTGAA pLKO.1 1199 CDS 100% 4.950 6.930 N MYH14 n/a
2 TRCN0000148431 CTCAATAAGCTACGGCTCAAA pLKO.1 3300 CDS 100% 4.950 3.960 N MYH14 n/a
3 TRCN0000275175 GTGCAGCACTCTGGCATTTAT pLKO_005 6279 3UTR 100% 15.000 10.500 N MYH14 n/a
4 TRCN0000275115 AGAGCTGAGAAGCGGCTTAAA pLKO_005 5763 CDS 100% 13.200 9.240 N MYH14 n/a
5 TRCN0000146426 CTCCTTTCTTCCCTCGTTATT pLKO.1 6451 3UTR 100% 13.200 9.240 N MYH14 n/a
6 TRCN0000275174 AGAAGAAGCAGCGCAAGTTTG pLKO_005 4567 CDS 100% 10.800 7.560 N MYH14 n/a
7 TRCN0000285308 GGGATTCAGCCACGAGGAAAT pLKO_005 1142 CDS 100% 10.800 7.560 N MYH14 n/a
8 TRCN0000149646 GCTCAAATATGAGGCCACAAT pLKO.1 3314 CDS 100% 4.950 3.465 N MYH14 n/a
9 TRCN0000148318 CAATGCCAAGACAGTGAAGAA pLKO.1 824 CDS 100% 4.950 2.970 N MYH14 n/a
10 TRCN0000275176 CAATGCCAAGACAGTGAAGAA pLKO_005 824 CDS 100% 4.950 2.970 N MYH14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145809.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.