Transcript: Human NM_001146009.1

Homo sapiens solute carrier organic anion transporter family member 5A1 (SLCO5A1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SLCO5A1 (81796)
Length:
3430
CDS:
497..2878

Additional Resources:

NCBI RefSeq record:
NM_001146009.1
NBCI Gene record:
SLCO5A1 (81796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423277 CAGTATACACAGCCGCTATTC pLKO_005 3008 3UTR 100% 10.800 15.120 N SLCO5A1 n/a
2 TRCN0000422837 GACCTTCATCCAGGCGTTAAT pLKO_005 907 CDS 100% 13.200 9.240 N SLCO5A1 n/a
3 TRCN0000038240 GCCTCAAATTCGTTGGGTTTA pLKO.1 2562 CDS 100% 10.800 7.560 N SLCO5A1 n/a
4 TRCN0000038243 CCTTCCCAGAAGCAATAAGTT pLKO.1 2802 CDS 100% 5.625 3.938 N SLCO5A1 n/a
5 TRCN0000038242 GCACTGGGAATGCAGTTTGTT pLKO.1 2384 CDS 100% 5.625 3.938 N SLCO5A1 n/a
6 TRCN0000038241 CCAACCTACTTAGATGACAAT pLKO.1 1352 CDS 100% 4.950 3.465 N SLCO5A1 n/a
7 TRCN0000038239 CCCAATGTTTACTTTCCCAAA pLKO.1 1585 CDS 100% 4.050 2.835 N SLCO5A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.