Transcript: Human NM_001146257.2

Homo sapiens zinc finger DHHC-type containing 15 (ZDHHC15), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
ZDHHC15 (158866)
Length:
850
CDS:
14..445

Additional Resources:

NCBI RefSeq record:
NM_001146257.2
NBCI Gene record:
ZDHHC15 (158866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414704 TGGGTGCCAGTGCTCGTTATT pLKO_005 77 CDS 100% 13.200 18.480 N Zdhhc15 n/a
2 TRCN0000440349 TCGTGCTCTGGTCCTACTATG pLKO_005 105 CDS 100% 10.800 15.120 N ZDHHC15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146257.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05099 pDONR223 100% 39.6% 34.9% None (many diffs) n/a
2 ccsbBroad304_05099 pLX_304 0% 39.6% 34.9% V5 (many diffs) n/a
3 TRCN0000478971 ATGGGTTCTGTAGGGCCGCCGCAA pLX_317 36.5% 39.6% 34.9% V5 (many diffs) n/a
Download CSV