Transcript: Mouse NM_001146287.1

Mus musculus CDK5 and Abl enzyme substrate 1 (Cables1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cables1 (63955)
Length:
3343
CDS:
533..2317

Additional Resources:

NCBI RefSeq record:
NM_001146287.1
NBCI Gene record:
Cables1 (63955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215592 GAGAAGTTTCCTCACATTAAA pLKO.1 1925 CDS 100% 15.000 21.000 N Cables1 n/a
2 TRCN0000248780 GAGAAGTTTCCTCACATTAAA pLKO_005 1925 CDS 100% 15.000 21.000 N Cables1 n/a
3 TRCN0000436363 GAATGGCAGAATAGTCCTTAT pLKO_005 1417 CDS 100% 10.800 8.640 N CABLES1 n/a
4 TRCN0000175727 GCTCTATGTTAGAGTGCATAA pLKO.1 3059 3UTR 100% 10.800 8.640 N Cables1 n/a
5 TRCN0000432589 AGGAGAAGTTTCCTCACATTA pLKO_005 1923 CDS 100% 13.200 9.240 N CABLES1 n/a
6 TRCN0000420407 GAAGATCCTTCTGTAGTATAT pLKO_005 1446 CDS 100% 13.200 9.240 N CABLES1 n/a
7 TRCN0000194643 GCCTTTGGGAACCGTAGAAAT pLKO.1 1637 CDS 100% 13.200 9.240 N Cables1 n/a
8 TRCN0000248781 GCCTTTGGGAACCGTAGAAAT pLKO_005 1637 CDS 100% 13.200 9.240 N Cables1 n/a
9 TRCN0000257813 TGTCCTTCCTCACCAACATTT pLKO_005 714 CDS 100% 13.200 9.240 N Cables1 n/a
10 TRCN0000248782 TGAGCCTGAAGGAGATCATTG pLKO_005 1545 CDS 100% 10.800 7.560 N Cables1 n/a
11 TRCN0000005410 CCTGGGAGACTTTATGGACTA pLKO.1 1765 CDS 100% 4.050 2.835 N CABLES1 n/a
12 TRCN0000176350 CCTGGAAGATATTGAAGAGAA pLKO.1 1297 CDS 100% 4.950 2.970 N Cables1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.