Transcript: Mouse NM_001146328.2

Mus musculus RNA binding motif protein 46 (Rbm46), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-12
Taxon:
Mus musculus (mouse)
Gene:
Rbm46 (633285)
Length:
2491
CDS:
188..1789

Additional Resources:

NCBI RefSeq record:
NM_001146328.2
NBCI Gene record:
Rbm46 (633285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05139 pDONR223 100% 90.6% 96.4% None (many diffs) n/a
2 ccsbBroad304_05139 pLX_304 0% 90.6% 96.4% V5 (many diffs) n/a
3 TRCN0000470520 GGTCCCGAACCTGGGCCTTGGTGT pLX_317 25.6% 90.6% 96.4% V5 (many diffs) n/a
Download CSV