Transcript: Mouse NM_001146348.1

Mus musculus endoglin (Eng), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Eng (13805)
Length:
3430
CDS:
364..2322

Additional Resources:

NCBI RefSeq record:
NM_001146348.1
NBCI Gene record:
Eng (13805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001146348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094358 AGGTGAATACTCCGTCAAGAT pLKO.1 1182 CDS 100% 4.950 6.930 N Eng n/a
2 TRCN0000094356 CCGTAATGATGGAACTGAGTT pLKO.1 1070 CDS 100% 4.950 6.930 N Eng n/a
3 TRCN0000094357 GCATCCAACACCATCGAACTA pLKO.1 1747 CDS 100% 4.950 3.960 N Eng n/a
4 TRCN0000094355 CCCTGCTGTTTGTCATCTATA pLKO.1 395 CDS 100% 13.200 9.240 N Eng n/a
5 TRCN0000094354 CCATGCTGCTTAGAAGCCTAA pLKO.1 2586 3UTR 100% 4.050 2.835 N Eng n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.