Transcript: Human NM_001146705.1

Homo sapiens lysine demethylase 5D (KDM5D), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
KDM5D (8284)
Length:
5595
CDS:
289..5001

Additional Resources:

NCBI RefSeq record:
NM_001146705.1
NBCI Gene record:
KDM5D (8284)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359114 TCACATTACGAACGCATTATT pLKO_005 751 CDS 100% 15.000 21.000 N KDM5D n/a
2 TRCN0000359189 CCTCGCGTCCAAAGGCTAAAT pLKO_005 487 CDS 100% 13.200 18.480 N KDM5D n/a
3 TRCN0000234753 GAGAAGGCAGTGGCAACAATA pLKO_005 4352 CDS 100% 13.200 18.480 N KDM5D n/a
4 TRCN0000022117 CGCGTCCAAAGGCTAAATGAA pLKO.1 490 CDS 100% 5.625 7.875 N KDM5D n/a
5 TRCN0000022114 CGATCACATTACGAACGCATT pLKO.1 748 CDS 100% 4.050 5.670 N KDM5D n/a
6 TRCN0000022115 GCCACATTGGAAGCCATAATT pLKO.1 3340 CDS 100% 15.000 12.000 N KDM5D n/a
7 TRCN0000234752 CCACATTGGAAGCCATAATTC pLKO_005 3341 CDS 100% 13.200 10.560 N KDM5D n/a
8 TRCN0000359116 GCCGAGAAGAAGAACATTATC pLKO_005 4811 CDS 100% 13.200 9.240 N KDM5D n/a
9 TRCN0000359115 GCTAGCATACAGGAGTGATTT pLKO_005 5213 3UTR 100% 13.200 9.240 N KDM5D n/a
10 TRCN0000234751 TGTATCTTGGCGGAGTGTAAA pLKO_005 1369 CDS 100% 13.200 9.240 N KDM5D n/a
11 TRCN0000359113 TTGCAGTAGAAGTTGACAATT pLKO_005 455 CDS 100% 13.200 9.240 N KDM5D n/a
12 TRCN0000234754 AGTGGCACCAAAGGTCATTTG pLKO_005 5003 3UTR 100% 10.800 7.560 N KDM5D n/a
13 TRCN0000359188 GACCTCTACAGCCTTAGTAAG pLKO_005 619 CDS 100% 10.800 7.560 N KDM5D n/a
14 TRCN0000359117 GGGAACGTGTCATCAACATTG pLKO_005 1123 CDS 100% 10.800 7.560 N KDM5D n/a
15 TRCN0000022116 CCAGTGCTAGATCAGTCTGTT pLKO.1 1789 CDS 100% 4.950 3.465 N KDM5D n/a
16 TRCN0000234750 CCAGTTTATTGACTCATATAT pLKO_005 1215 CDS 100% 15.000 9.000 N KDM5D n/a
17 TRCN0000359186 CTAGAGTGAAATTGAACTATT pLKO_005 524 CDS 100% 13.200 7.920 N KDM5D n/a
18 TRCN0000022118 CAGCCCTTTCTTGAAAGGAAA pLKO.1 4881 CDS 100% 0.495 0.297 N KDM5D n/a
19 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1729 CDS 100% 1.080 0.540 Y GPR83 n/a
20 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1729 CDS 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.