Transcript: Mouse NM_001159290.1

Mus musculus B cell CLL/lymphoma 11A (zinc finger protein) (Bcl11a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Bcl11a (14025)
Length:
1480
CDS:
147..722

Additional Resources:

NCBI RefSeq record:
NM_001159290.1
NBCI Gene record:
Bcl11a (14025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096549 GCTCCGTTATCCTGCTAGATT pLKO.1 771 3UTR 100% 5.625 7.875 N Bcl11a n/a
2 TRCN0000096551 CCGCAGGGTATTTGTAAAGAT pLKO.1 465 CDS 100% 5.625 4.500 N Bcl11a n/a
3 TRCN0000450182 GTGCTTAACATTGACATAATA pLKO_005 1081 3UTR 100% 15.000 10.500 N Bcl11a n/a
4 TRCN0000448972 ACAGAACACTCATGGATTAAG pLKO_005 557 CDS 100% 13.200 9.240 N Bcl11a n/a
5 TRCN0000033451 CCAGAGGATGACGATTGTTTA pLKO.1 309 CDS 100% 13.200 9.240 N BCL11A n/a
6 TRCN0000096550 GCCAGAGGATGACGATTGTTT pLKO.1 308 CDS 100% 5.625 3.938 N Bcl11a n/a
7 TRCN0000096553 CACAAACGGAAACAATGCAAT pLKO.1 186 CDS 100% 4.950 3.465 N Bcl11a n/a
8 TRCN0000033449 CGCACAGAACACTCATGGATT pLKO.1 554 CDS 100% 4.950 3.465 N BCL11A n/a
9 TRCN0000033450 GCTCAAGATGTGTGGCAGTTT pLKO.1 659 CDS 100% 4.950 2.970 N BCL11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.