Transcript: Mouse NM_001159520.1

Mus musculus paired box 3 (Pax3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pax3 (18505)
Length:
3376
CDS:
388..1842

Additional Resources:

NCBI RefSeq record:
NM_001159520.1
NBCI Gene record:
Pax3 (18505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075365 CCGCATCCTGAGGAGTAAATT pLKO.1 852 CDS 100% 15.000 12.000 N Pax3 n/a
2 TRCN0000348078 GCATTCGGCCTTGCGTCATTT pLKO_005 584 CDS 100% 13.200 9.240 N Pax3 n/a
3 TRCN0000348000 GCCGCATCCTGAGGAGTAAAT pLKO_005 851 CDS 100% 13.200 9.240 N Pax3 n/a
4 TRCN0000075364 GCTGGGAAATCAGAGACAAAT pLKO.1 776 CDS 100% 13.200 9.240 N Pax3 n/a
5 TRCN0000333918 GCTGGGAAATCAGAGACAAAT pLKO_005 776 CDS 100% 13.200 9.240 N Pax3 n/a
6 TRCN0000348077 TCTTACCAGCCCACGTCTATT pLKO_005 1318 CDS 100% 13.200 9.240 N Pax3 n/a
7 TRCN0000075367 CGTGCAAGATGGAGGAAACAA pLKO.1 1198 CDS 100% 5.625 3.938 N Pax3 n/a
8 TRCN0000075366 AGCTGGGAAATCAGAGACAAA pLKO.1 775 CDS 100% 4.950 3.465 N Pax3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06689 pDONR223 100% 38.2% 40.7% None (many diffs) n/a
2 ccsbBroad304_06689 pLX_304 0% 38.2% 40.7% V5 (many diffs) n/a
3 TRCN0000468147 TGGATAAGGCTGATTCTCCTTGGT pLX_317 61.4% 38.2% 40.7% V5 (many diffs) n/a
Download CSV