Transcript: Mouse NM_001159647.1

Mus musculus contactin 1 (Cntn1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cntn1 (12805)
Length:
5817
CDS:
377..3439

Additional Resources:

NCBI RefSeq record:
NM_001159647.1
NBCI Gene record:
Cntn1 (12805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039018 CGGCAATCTCTACATCGCAAA pLKO.1 955 CDS 100% 4.050 5.670 N Cntn1 n/a
2 TRCN0000039015 GCAGCCAATCAATACCATTTA pLKO.1 511 CDS 100% 13.200 10.560 N Cntn1 n/a
3 TRCN0000425409 ACAAATCCCACACGAATTATT pLKO_005 1880 CDS 100% 15.000 10.500 N Cntn1 n/a
4 TRCN0000420210 ACCATGGATAAGCGAAGATTT pLKO_005 920 CDS 100% 13.200 9.240 N Cntn1 n/a
5 TRCN0000039017 CCTGGCTTTAGCTCCAACTTT pLKO.1 1600 CDS 100% 5.625 3.938 N Cntn1 n/a
6 TRCN0000039014 GCCAAACAAATTAGACTCTAA pLKO.1 3535 3UTR 100% 4.950 3.465 N Cntn1 n/a
7 TRCN0000039016 GCCTTCAACAATAAAGGAGAT pLKO.1 2738 CDS 100% 4.050 2.835 N Cntn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.