Transcript: Human NM_001160130.2

Homo sapiens potassium voltage-gated channel subfamily Q member 5 (KCNQ5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-19
Taxon:
Homo sapiens (human)
Gene:
KCNQ5 (56479)
Length:
6337
CDS:
127..2898

Additional Resources:

NCBI RefSeq record:
NM_001160130.2
NBCI Gene record:
KCNQ5 (56479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160130.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425684 GCTAATAAGGTATCAACTAAA pLKO_005 3335 3UTR 100% 13.200 18.480 N KCNQ5 n/a
2 TRCN0000044664 CGGAAGTTTAAGGAAACATTA pLKO.1 1702 CDS 100% 13.200 10.560 N KCNQ5 n/a
3 TRCN0000044667 GCAGTTCATTCTGACGCCAAA pLKO.1 2163 CDS 100% 4.050 3.240 N KCNQ5 n/a
4 TRCN0000425131 ACAGGTGCCAATTAGTCAAAG pLKO_005 2241 CDS 100% 10.800 7.560 N KCNQ5 n/a
5 TRCN0000044666 CCAACCTCATTCAGTGTGTTT pLKO.1 1238 CDS 100% 4.950 3.465 N KCNQ5 n/a
6 TRCN0000044665 CCTTTGCATCAGACTCTCTAA pLKO.1 2789 CDS 100% 4.950 3.465 N KCNQ5 n/a
7 TRCN0000044663 GCAGGCTTACAGGAAAGCATT pLKO.1 2410 CDS 100% 4.950 3.465 N KCNQ5 n/a
8 TRCN0000069960 TGTTTCCATTGCAACCTGGAA pLKO.1 1287 CDS 100% 0.264 0.185 N LOC381252 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5066 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160130.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.