Transcript: Human NM_001160154.1

Homo sapiens alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase A (MGAT4A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
MGAT4A (11320)
Length:
3726
CDS:
115..1386

Additional Resources:

NCBI RefSeq record:
NM_001160154.1
NBCI Gene record:
MGAT4A (11320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372978 ACGATTAGAAGATGGCTATTT pLKO_005 1170 CDS 100% 13.200 18.480 N MGAT4A n/a
2 TRCN0000035810 CCGGATCTTACTCTGATTGTA pLKO.1 637 CDS 100% 5.625 7.875 N MGAT4A n/a
3 TRCN0000372977 ACTCACGGATAAAGATTATAT pLKO_005 852 CDS 100% 15.000 10.500 N MGAT4A n/a
4 TRCN0000035812 CCAGTCAATGTAGAAAGTTAT pLKO.1 1036 CDS 100% 13.200 9.240 N MGAT4A n/a
5 TRCN0000035813 GCCAACCTGGAGAAAGAATTT pLKO.1 298 CDS 100% 13.200 7.920 N MGAT4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.