Transcript: Human NM_001160167.2

Homo sapiens proline rich 5 like (PRR5L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
PRR5L (79899)
Length:
3851
CDS:
277..1383

Additional Resources:

NCBI RefSeq record:
NM_001160167.2
NBCI Gene record:
PRR5L (79899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136523 CCACTGAATGAGATGGTCTTG pLKO.1 1063 CDS 100% 4.050 5.670 N PRR5L n/a
2 TRCN0000436439 TATGCGATGCTGCCTTATTTC pLKO_005 1474 3UTR 100% 13.200 10.560 N PRR5L n/a
3 TRCN0000416352 TGTAGTGACCAGTTGCCTAAT pLKO_005 1593 3UTR 100% 10.800 8.640 N PRR5L n/a
4 TRCN0000134566 GAGTGAACTTGGATCATTCAT pLKO.1 534 CDS 100% 5.625 4.500 N PRR5L n/a
5 TRCN0000137272 CGGCTGTTGAAGAGTGAACTT pLKO.1 523 CDS 100% 4.950 3.960 N PRR5L n/a
6 TRCN0000215609 GTGAACTTGGATCATTCATTA pLKO.1 536 CDS 100% 13.200 9.240 N Prr5l n/a
7 TRCN0000432357 TGCAAAGCAACGAGCTCTATG pLKO_005 482 CDS 100% 10.800 7.560 N PRR5L n/a
8 TRCN0000133670 GAAGAGTGAACTTGGATCATT pLKO.1 531 CDS 100% 5.625 3.938 N PRR5L n/a
9 TRCN0000173760 CAAGGTGACTGTCCTGAACTA pLKO.1 1014 CDS 100% 4.950 3.465 N Prr5l n/a
10 TRCN0000137083 CGTTCAGACTGCTGTGATCAA pLKO.1 441 CDS 100% 4.950 3.465 N PRR5L n/a
11 TRCN0000133894 CCAAGTGAGAGTTATTTGCAA pLKO.1 883 CDS 100% 3.000 2.100 N PRR5L n/a
12 TRCN0000135734 CCCAAGTGAGAGTTATTTGCA pLKO.1 882 CDS 100% 3.000 2.100 N PRR5L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.